Top » Catalog » SNPs » Z196

$18.00

Z196
[Z196]

Z196
hg38 Position: ChrY:18871818..18871819
Ancestral: ins
Derived: del
Reference: found by rrocca
ISOGG Haplogroup: R1b1a1a2a1a2a1
Comments: beneath P312. upstream of L176.2
Forward Primer: Z196v2_F TTCAGATTTTAACTGTAAGTCTATGCTG
Reverse Primer: Z196v2_R TCTGCTTCATTTTATATTAATTGCTTG
Reviews

Customers who bought this product also purchased
BY16029
BY16029
FT65663
FT65663
BY21429
BY21429
Z29954
Z29954
BY190237
BY190237
A11619
A11619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies