Top » Catalog » SNPs » Z198

$18.00

Z198
[Z198]

Z198
hg38 Position: ChrY:14481954..14481954
Ancestral: G
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a1b
Comments: downstream of R-P312
Forward Primer: Z198_F CTCTGCTCCTTCGGTTCAAG
Reverse Primer: Z198_R TTGGTGGAAGAGAGTTCTGC
Reviews

Customers who bought this product also purchased
Y6951
Y6951
Z2560
Z2560
DF79
DF79
A6137
A6137
A11366
A11366
FGC17112
FGC17112
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies