Top » Catalog » SNPs » Z198

$18.00

Z198
[Z198]

Z198
hg38 Position: ChrY:14481954..14481954
Ancestral: G
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a1b
Comments: downstream of R-P312
Forward Primer: Z198_F CTCTGCTCCTTCGGTTCAAG
Reverse Primer: Z198_R TTGGTGGAAGAGAGTTCTGC
Reviews

Customers who bought this product also purchased
S6218
S6218
A11752
A11752
A431
A431
Z196
Z196
BY1058
BY1058
Y14084
Y14084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies