Top » Catalog » SNPs » Z198

$18.00

Z198
[Z198]

Z198
hg38 Position: ChrY:14481954..14481954
Ancestral: G
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a1b
Comments: downstream of R-P312
Forward Primer: Z198_F CTCTGCTCCTTCGGTTCAAG
Reverse Primer: Z198_R TTGGTGGAAGAGAGTTCTGC
Reviews

Customers who bought this product also purchased
Z296
Z296
R1b-DF27 Panel
R1b-DF27 Panel
DF27
DF27
Z2571
Z2571
Z225
Z225
FGC20764
FGC20764
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y3032
$18.00
Haplogroup Info
Other products
Currencies