Top » Catalog » SNPs » Z17614

$18.00

Z17614
[Z17614]

Z17614
hg38 Position: ChrY:16651237..16651237
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of L1335>L1065
Forward Primer: Z17614_F AGCCATGGGAGGACTGAC
Reverse Primer: Z17614_R CCACACTCTGGCTTCAACTC
Reviews

Customers who bought this product also purchased
BY150
BY150
FGC32994
FGC32994
S9767
S9767
FGC45280
FGC45280
BY154
BY154
FGC18451
FGC18451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies