Top » Catalog » SNPs » P109

$18.00

P109
[P109]

P109
hg38 Position: ChrY:13314125..13314125
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: I1a1b1
Comments: UTY AluY83
Forward Primer: P109_F ATCGGTTTCGTCTGGGAAC
Reverse Primer: P109_R CCTGGCCCTTTCTTTATTTG
Reviews

Customers who bought this product also purchased
Y24054
Y24054
Y98743
Y98743
Z2045
Z2045
Y23449
Y23449
BY35379
BY35379
Z133
Z133
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies