Top » Catalog » SNPs » P109

$18.00

P109
[P109]

P109
hg38 Position: ChrY:13314125..13314125
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: I1a1b1
Comments: UTY AluY83
Forward Primer: P109_F ATCGGTTTCGTCTGGGAAC
Reverse Primer: P109_R CCTGGCCCTTTCTTTATTTG
Reviews

Customers who bought this product also purchased
FGC28767
FGC28767
PH497
PH497
Y7477
Y7477
Z2041
Z2041
S1953
S1953
Y7140
Y7140
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies