Top » Catalog » SNPs » P109

$18.00

P109
[P109]

P109
hg38 Position: ChrY:13314125..13314125
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: I1a1b1
Comments: UTY AluY83
Forward Primer: P109_F ATCGGTTTCGTCTGGGAAC
Reverse Primer: P109_R CCTGGCCCTTTCTTTATTTG
Reviews

Customers who bought this product also purchased
Y19413
Y19413
Y20037
Y20037
Y23527
Y23527
Y19675
Y19675
PH159
PH159
Y19934
Y19934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies