Top » Catalog » SNPs » P109

$18.00

P109
[P109]

P109
hg38 Position: ChrY:13314125..13314125
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: I1a1b1
Comments: UTY AluY83
Forward Primer: P109_F ATCGGTTTCGTCTGGGAAC
Reverse Primer: P109_R CCTGGCCCTTTCTTTATTTG
Reviews

Customers who bought this product also purchased
S4795
S4795
Z58
Z58
Z2336
Z2336
Y23646
Y23646
Y30547
Y30547
Y23647
Y23647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies