Top » Catalog » SNPs » A725

$18.00

A725
[A725]

A725
hg38 Position: ChrY:7737991..7737991
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1b1
Comments: Below FGC4077
Forward Primer: A725_F AGCACTGTCAGCACACTTGC
Reverse Primer: A725_R TGTGAATCATGAGCAAATTTCAG
Reviews

Customers who bought this product also purchased
FGC42654
FGC42654
FGC42642
FGC42642
FGC42645
FGC42645
FGC42653
FGC42653
FGC42641
FGC42641
FGC42643
FGC42643
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies