Top » Catalog » SNPs » A725

$18.00

A725
[A725]

A725
hg38 Position: ChrY:7737991..7737991
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1b1
Comments: Below FGC4077
Forward Primer: A725_F AGCACTGTCAGCACACTTGC
Reverse Primer: A725_R TGTGAATCATGAGCAAATTTCAG
Reviews

Customers who bought this product also purchased
FGC42643
FGC42643
FGC42652
FGC42652
FGC42640
FGC42640
FGC42651
FGC42651
FGC42650
FGC42650
R1b-A725 Ross Panel
R1b-A725 Ross Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies