Top » Catalog » SNPs » A725

$18.00

A725
[A725]

A725
hg38 Position: ChrY:7737991..7737991
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1b1
Comments: Below FGC4077
Forward Primer: A725_F AGCACTGTCAGCACACTTGC
Reverse Primer: A725_R TGTGAATCATGAGCAAATTTCAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
DF85
DF85
FGC42650
FGC42650
R1b-A725 Ross Panel
R1b-A725 Ross Panel
FGC42648
FGC42648
FGC42649
FGC42649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z44622
1 x A1669
1 x Z39695
1 x A4577
1 x A1583
1 x A2014
1 x Z46185
1 x Z39866
$144.00
Haplogroup Info
Other products
Currencies