Top » Catalog » SNPs » Z467

$18.00

Z467
[Z467]

Z467
hg38 Position: ChrY:12443506..12443506
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J2a1a2a2b2
Comments: Downstream of M67. approximately equivalent to L227 & L218
Forward Primer: Z467_F ACCTGTAAGCAGAAAAGGATGC
Reverse Primer: Z467_R GTGCACATTGAGGGCATG
Reviews

Customers who bought this product also purchased
CTS6804
CTS6804
Y25813
Y25813
Z7671
Z7671
Y13640
Y13640
M92
M92
Y13654
Y13654
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies