Top » Catalog » SNPs » Z467

$18.00

Z467
[Z467]

Z467
hg38 Position: ChrY:12443506..12443506
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J2a1a2a2b2
Comments: Downstream of M67. approximately equivalent to L227 & L218
Forward Primer: Z467_F ACCTGTAAGCAGAAAAGGATGC
Reverse Primer: Z467_R GTGCACATTGAGGGCATG
Reviews

Customers who bought this product also purchased
Y13654
Y13654
J2a-M67 Panel
J2a-M67 Panel
S12459
S12459
Y11202
Y11202
CTS6804
CTS6804
Y25813
Y25813
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies