Top » Catalog » SNPs » Z467

$18.00

Z467
[Z467]

Z467
hg38 Position: ChrY:12443506..12443506
Ancestral: C
Derived: T
Reference: Bonnie Schrack (2011)
ISOGG Haplogroup: J2a1a2a2b2
Comments: Downstream of M67. approximately equivalent to L227 & L218
Forward Primer: Z467_F ACCTGTAAGCAGAAAAGGATGC
Reverse Primer: Z467_R GTGCACATTGAGGGCATG
Reviews

Customers who bought this product also purchased
A25792
A25792
Y15238
Y15238
FGC21388
FGC21388
FGC21362
FGC21362
Y15915
Y15915
FGC21373
FGC21373
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies