Top » Catalog » SNPs » FGC3243

$18.00

FGC3243
[FGC3243]

FGC3243
hg38 Position: ChrY:12181227..12181227
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3243_F GGGAGCGTTGGAAAGCAC
Reverse Primer: FGC3243_R GGAGAACCACTACTCTCTCTTCAAC
Reviews

Customers who bought this product also purchased
FGC3246
FGC3246
FGC3267
FGC3267
FGC3242
FGC3242
FGC3263
FGC3263
PF825.2
PF825.2
FGC3259
FGC3259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies