Top » Catalog » SNPs » FGC3246

$18.00

FGC3246
[FGC3246]

FGC3246
hg38 Position: ChrY:13646599..13646599
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3246_F CCAAATGTGATGGAAAATGTCC
Reverse Primer: FGC3246_R CATAAGTGGGAATTGAGCAACTG
Reviews

Customers who bought this product also purchased
PF825.2
PF825.2
FGC3259
FGC3259
L430
L430
R1b-PF825.2 downstream
R1b-PF825.2 downstream
FGC3250
FGC3250
L1495
L1495
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies