Top » Catalog » SNPs » FGC3248

$18.00

FGC3248
[FGC3248]

FGC3248
hg38 Position: ChrY:15162283..15162283
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3248_F CTTTACCCACTGTGTCAGTCTTCTC
Reverse Primer: FGC3248_R TGACCTAACGGATGCACAGAC
Reviews

Customers who bought this product also purchased
L1495
L1495
FGC3246
FGC3246
FGC3268
FGC3268
FGC3243
FGC3243
FGC3267
FGC3267
FGC3242
FGC3242
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies