Top » Catalog » SNPs » FGC3259

$18.00

FGC3259
[FGC3259]

FGC3259
hg38 Position: ChrY:18450178..18450178
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3259_F TGATCAGCAATGATATTCCCTATG
Reverse Primer: FGC3259_R ACATTTAGGAGCAGGCTGTAAATC
Reviews

Customers who bought this product also purchased
FGC3242
FGC3242
FGC3263
FGC3263
PF825.2
PF825.2
FGC3250
FGC3250
L430
L430
R1b-PF825.2 downstream
R1b-PF825.2 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies