Top » Catalog » SNPs » FGC3259

$18.00

FGC3259
[FGC3259]

FGC3259
hg38 Position: ChrY:18450178..18450178
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3259_F TGATCAGCAATGATATTCCCTATG
Reverse Primer: FGC3259_R ACATTTAGGAGCAGGCTGTAAATC
Reviews

Customers who bought this product also purchased
L430
L430
R1b-PF825.2 downstream
R1b-PF825.2 downstream
FGC3248
FGC3248
L1495
L1495
FGC3246
FGC3246
FGC3268
FGC3268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies