Top » Catalog » SNPs » FGC3263

$18.00

FGC3263
[FGC3263]

FGC3263
hg38 Position: ChrY:19881499..19881499
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b1a2a1a2c1f3 (not listed)
Comments: Below PF825.2
Forward Primer: FGC3263_F TCTGGCAAGTATAAAGCCACAG
Reverse Primer: FGC3263_R CTGTGGTCCCTTTCTTTTGAG
Reviews

Customers who bought this product also purchased
FGC3243
FGC3243
FGC3267
FGC3267
FGC3242
FGC3242
FGC3259
FGC3259
PF825.2
PF825.2
FGC3250
FGC3250
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies