Top » Catalog » SNPs » L1495

$18.00

L1495
[L1495]

L1495
hg38 Position: ChrY:15484155..15484155
Ancestral: C
Derived: T
Reference: Thomas Krahn / WTY (2012)
ISOGG Haplogroup: not listed
Comments: Found in a hg B-M60 WTY participant
Forward Primer: L1495_F GGAAAGCTCTTAGCAGGAGTAGC
Reverse Primer: L1495_R GTCCATCACTGAACTCCAATTG
Reviews

Customers who bought this product also purchased
FGC3263
FGC3263
FGC3242
FGC3242
FGC3259
FGC3259
PF825.2
PF825.2
FGC3250
FGC3250
L430
L430
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies