Top » Catalog » SNPs » S24402

$18.00

S24402
[S24402]

S24402
HG19 Position: ChrY:20392420..20392420
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: S24402_F TTTATTGTTAGCATGCAGAAACAC
Reverse Primer: S24402_R TTGTGACGAACAGGCAACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies