Top » Catalog » SNPs » A15071

$18.00

A15071
[A15071]

A15071
hg38 Position: ChrY:7879941..7879941
Ancestral: G
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15071_F ATGTGAGGTGGTGACAGTCC
Reverse Primer: A15071_R CAAGGGGTGTTGTCCCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies