Top » Catalog » SNPs » A15072

$18.00

A15072
[A15072]

A15072
HG19 Position: ChrY:8609830..8609830
Ancestral: C
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15072_F AAAACACAGCTCCACCTTGG
Reverse Primer: A15072_R ATCAGGAAAAAGGCTGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies