Top » Catalog » SNPs » A15073

$17.50

A15073
[A15073]

A15073
HG19 Position: ChrY:16906044..16906044
Ancestral: T
Derived: A
Reference: Rachel Unkefer (2017)
ISOGG Haplogroup: J2
Comments: Downstream Y26712
Forward Primer: A15073_F CAGCTGGATTTGACCTAAAATTACTC
Reverse Primer: A15073_R AATAACCATAGGGTGTGGTTTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies