Top » Catalog » SNPs » YFS1797412

$18.00

YFS1797412
[YFS1797412]

YFS1797412
HG19 Position: ChrY:23442206..23442206
Ancestral: C
Derived: T
Reference: John M Rhodes (2017)
ISOGG Haplogroup: I1
Comments:
Forward Primer: YFS1797412_F AAATTAGTGAAGCCAGGAGCTG
Reverse Primer: YFS1797412_R CCCTCTTTTTCCATTGTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies