Top » Catalog » SNPs » Y23905

$17.50

Y23905
[Y23905]

Y23905
HG19 Position: ChrY:14328288..14328288
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I1a2a1a1a1 (unlisted)
Comments: Below I-A376
Forward Primer: Y23905_F ATAGTGGTGAAGTCTGGGCTTTTAG
Reverse Primer: Y23905_R ATTTCCTTTACCTCCCATTTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies