Top » Catalog » SNPs » A15076

$19.00

A15076
[A15076]

A15076
hg38 Position: ChrY:19683050..19683050
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2a1a2a1a (not listed)
Comments: Below L233 > Y4252
Forward Primer: A15076_F ATCATCCTGAAGGGGAGGAG
Reverse Primer: A15076_R ATCCCCCAGAAATCACCTTC
Reviews

Customers who bought this product also purchased
PF4294
PF4294
Y85503
Y85503
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Z105
Z105
Y98004
Y98004
P37.2
P37.2
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies