Top » Catalog » SNPs » BZ3140

$18.00

BZ3140
[BZ3140]

BZ3140
hg38 Position: ChrY:14339315..14339315
Ancestral: T
Derived: A
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q (not listed)
Comments: Below YP4000
Forward Primer: BZ3140_F AGGGAACCAAGCTTAGAAGACC
Reverse Primer: BZ3140_R ATTCATCCTGGCAATTCCC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
YP4055
YP4055
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies