Top » Catalog » SNPs » YP4055

$18.00

YP4055
[YP4055]

YP4055
HG19 Position: ChrY:19531901..19531901
Ancestral: C
Derived: A
Reference: YDNA-community (2015)
ISOGG Haplogroup: Q
Comments: Below YP4000
Forward Primer: YP4055_F AGGTGACATCATAACTGATACTCCAG
Reverse Primer: YP4055_R CATTTTGTCACTGGTGTCATCTC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
BZ3140
BZ3140
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies