Top » Catalog » SNPs » Z40052

$18.00

Z40052
[Z40052]

Z40052
hg38 Position: ChrY:21267123..21267123
Ancestral: C
Derived: T
Reference: Chris Rottensteiner (2016)
ISOGG Haplogroup: J2b2
Comments: J2b2-CTS3617(xCTS6190 PH1602)
Forward Primer: Z40052_F TGCTTAGTCTGCAAGCTGTCC
Reverse Primer: Z40052_R GGTAAATCCCAGCCCATTC
Reviews

Customers who bought this product also purchased
PH2350
PH2350
Z38240
Z38240
M438
M438
M12
M12
Y86930
Y86930
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies