Top » Catalog » SNPs » Z40052

$18.00

Z40052
[Z40052]

Z40052
hg38 Position: ChrY:21267123..21267123
Ancestral: C
Derived: T
Reference: Chris Rottensteiner (2016)
ISOGG Haplogroup: J2b2
Comments: J2b2-CTS3617(xCTS6190 PH1602)
Forward Primer: Z40052_F TGCTTAGTCTGCAAGCTGTCC
Reverse Primer: Z40052_R GGTAAATCCCAGCCCATTC
Reviews

Customers who bought this product also purchased
Z575
Z575
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
PH1568
PH1568
M201
M201
M410
M410
Y130898
Y130898
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies