Top » Catalog » SNPs » FGC35461

$18.00

FGC35461
[FGC35461]

FGC35461
hg38 Position: ChrY:4245778..4245778
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Below FGC35472
Forward Primer: FGC35461_F TCCTTTGGCAAGGAAATAAATG
Reverse Primer: FGC35461_R AGACGTAGAAAGCGAGAGCAC
Reviews

Customers who bought this product also purchased
PF5401
PF5401
FGC30343
FGC30343
Z7700
Z7700
Z38707
Z38707
L25
L25
L243
L243
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies