Top » Catalog » SNPs » Y24651

$18.00

Y24651
[Y24651]

Y24651
hg38 Position: ChrY:17398287..17398287
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Aka FGC54172; below PF5456
Forward Primer: Y24651v2_F CCTTAATCTTGAACTTACAGCCTCTG
Reverse Primer: Y24651v2_R AAAAAAAGAGATCAGTTAGTTGTAGATGTG
Reviews

Customers who bought this product also purchased
FGC21080
FGC21080
FGC21092
FGC21092
J2-BY268-Kessler Panel
J2-BY268-Kessler Panel
FGC21079
FGC21079
FGC21090
FGC21090
FGC21077
FGC21077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies