Top » Catalog » SNPs » Z39491

$18.00

Z39491
[Z39491]

Z39491
hg38 Position: ChrY:6993026..6993026
Ancestral: G
Derived: C
Reference: Alfred Aburto (2015)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Downstream BY268, FGC21085
Forward Primer: Z39491_F CCTGGAGTTAGCGCCTCTC
Reverse Primer: Z39491_R AGGAACTTGGAGGACACAGC
Reviews

Customers who bought this product also purchased
CTS6061
CTS6061
FGC21080
FGC21080
Z2177
Z2177
L396
L396
PF5401
PF5401
Z40772
Z40772
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies