Top » Catalog » SNPs » Z39491

$18.00

Z39491
[Z39491]

Z39491
hg38 Position: ChrY:6993026..6993026
Ancestral: G
Derived: C
Reference: Alfred Aburto (2015)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Downstream BY268, FGC21085
Forward Primer: Z39491_F CCTGGAGTTAGCGCCTCTC
Reverse Primer: Z39491_R AGGAACTTGGAGGACACAGC
Reviews

Customers who bought this product also purchased
FGC21085
FGC21085
L70
L70
FGC6724
FGC6724
J2a-L24 Panel
J2a-L24 Panel
CTS6061
CTS6061
FGC21080
FGC21080
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies