Top » Catalog » SNPs » Z40772

$18.00

Z40772
[Z40772]

Z40772
hg38 Position: ChrY:13145771..13145771
Ancestral: G
Derived: A
Reference: Al Aburto (2016)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Below PF5456 & FGC6724
Forward Primer: Z40772_F TGCTAAGGTTGAAACATAAACAAATAC
Reverse Primer: Z40772_R GAGCTGGGGATAGTTAATGAGTACC
Reviews

Customers who bought this product also purchased
Z39491
Z39491
L396
L396
FGC21080
FGC21080
L24
L24
Z2227
Z2227
L26
L26
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies