Top » Catalog » SNPs » Z40772

$18.00

Z40772
[Z40772]

Z40772
hg38 Position: ChrY:13145771..13145771
Ancestral: G
Derived: A
Reference: Al Aburto (2016)
ISOGG Haplogroup: J2a1h2a1 (unlisted)
Comments: Below PF5456 & FGC6724
Forward Primer: Z40772_F TGCTAAGGTTGAAACATAAACAAATAC
Reverse Primer: Z40772_R GAGCTGGGGATAGTTAATGAGTACC
Reviews

Customers who bought this product also purchased
Z39491
Z39491
L396
L396
FGC21080
FGC21080
J2-M172 Superclade Panel
J2-M172 Superclade Panel
L24
L24
Z2227
Z2227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies