Top » Catalog » SNPs » MZ90

$18.00

MZ90
[MZ90]

MZ90
hg38 Position: ChrY:15682097..15682100
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
ALK777
ALK777
MZ278
MZ278
BY9698
BY9698
BY9699
BY9699
BY9954
BY9954
MZ149
MZ149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies