Top » Catalog » SNPs » MZ90

$18.00

MZ90
[MZ90]

MZ90
HG19 Position: ChrY:17793977..17793980
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
MZ7
MZ7
MZ3
MZ3
PF6789
PF6789
A2227
A2227
CTS11456
CTS11456
Z5009
Z5009
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies