Top » Catalog » SNPs » MZ90

$18.00

MZ90
[MZ90]

MZ90
HG19 Position: ChrY:15682097..15682100
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
A5603
A5603
A5604
A5604
PF2578
PF2578
PF6788
PF6788
MZ99
MZ99
A930
A930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies