Top » Catalog » SNPs » MZ90

$17.50

MZ90
[MZ90]

MZ90
HG19 Position: ChrY:17793977..17793980
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
CTS11456
CTS11456
Z5009
Z5009
Y20077
Y20077
M81
M81
MZ131
MZ131
E1b-L19 Panel
E1b-L19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies