Top » Catalog » SNPs » MZ90

$18.00

MZ90
[MZ90]

MZ90
hg38 Position: ChrY:15682097..15682100
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
Z5011
Z5011
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M78
M78
M9
M9
M304
M304
MZ146
MZ146
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies