Top » Catalog » SNPs » MZ90

$18.00

MZ90
[MZ90]

MZ90
hg38 Position: ChrY:15682097..15682100
Ancestral: ins
Derived: del
Reference: Bachir (2015)
ISOGG Haplogroup: E1b1b1b1a
Comments: Equivalent to PF6794
Forward Primer: MZ90_F CACATCTCATTGTCATCCATACATAC
Reverse Primer: MZ90_R GGAAGGAAGGAAATAAATAGGACAG
Reviews

Customers who bought this product also purchased
Y215326
Y215326
FGC34334
FGC34334
A24296
A24296
Y10541
Y10541
Z21384
Z21384
Y196647
Y196647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies