Top » Catalog » SNPs » A15162

$18.00

A15162
[A15162]

A15162
hg38 Position: ChrY:12990745..12990745
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2017)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: A15162_F TCTAAACTTCTCTTCACGCTTCG
Reverse Primer: A15162_R TGAACGGAGAATGACTTTGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies