Top » Catalog » SNPs » L332

$18.00

L332
[L332]

L332
hg38 Position: ChrY:14087015..14087015
Ancestral: C
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a1c1
Comments: Found in a hg Q-L53* WTY participant
Forward Primer: L332_F TGTGAATGAGAATGATTGGACTG
Reverse Primer: L332_R AAGCTGGGTCACATAGTGCAG
Reviews

Customers who bought this product also purchased
L334
L334
Q1b-L53 Panel
Q1b-L53 Panel
YP1695
YP1695
YP4554
YP4554
YP4560
YP4560
Y31277
Y31277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies