Top » Catalog » SNPs » A15481

$18.00

A15481
[A15481]

A15481
hg38 Position: ChrY:19931185..19931185
Ancestral: A
Derived: T
Reference: Ed Aber Leek (2017
ISOGG Haplogroup: R1b
Comments: Below FGC11388
Forward Primer: A15481_F AACCATGTGACACAAGTTTACCTATG
Reverse Primer: A15481_R CACAAACAGAAAATCTAGAGAAAGGTTAATAC
Reviews

Customers who bought this product also purchased
A12542
A12542
A12541
A12541
A15480
A15480
A12540
A12540
A15479
A15479
A12539
A12539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies