Top » Catalog » SNPs » BY9874

$18.00

BY9874
[BY9874]

BY9874
hg38 Position: ChrY:20850278..20850278
Ancestral: A
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below L19
Forward Primer: BY9874_F GCAGGTTGTGTTAGCCAGTG
Reverse Primer: BY9874_R TGAGAGTTAACTCACAGAGTCTGTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies