Top » Catalog » SNPs » Y31317

$18.00

Y31317
[Y31317]

Y31317
hg38 Position: ChrY:17282271..17282271
Ancestral: C
Derived: T
Reference: Anton Rakitin (2017)
ISOGG Haplogroup: none
Comments: reported as sequencing error
Forward Primer: Y31317_F CTTGTCCCAGACCACAAACC
Reverse Primer: Y31317_R GTGGCTAACACGGTGAAACC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies