Top » Catalog » SNPs » Y2245

$18.00

Y2245
[Y2245]

Y2245
hg38 Position: ChrY:7026282..7026282
Ancestral: C
Derived: T
Reference: Vladimir Gurianov (2013)
ISOGG Haplogroup: Q1b1 (not listed)
Comments: Q-Y2250 level downstream of M378
Forward Primer: Y2245_F AAATAAGTGCCCTCCCCATC
Reverse Primer: Y2245_R CGTGAGTCTCTTTGGCCTTC
Reviews

Customers who bought this product also purchased
Z58
Z58
S10360
S10360
M9
M9
DF29
DF29
L1237
L1237
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies