Top » Catalog » SNPs » Z80

$18.00

Z80
[Z80]

Z80
hg38 Position: ChrY:7487796..7487796
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a3~
Comments: beneath L48. parallel to L47;downstream of Z9. Z10. parallel to Z30
Forward Primer: Z80_F CCAGGAGAGACAACGGTGAG
Reverse Primer: Z80_R TGCATACACATGCACACAAG
Reviews

Customers who bought this product also purchased
Z9
Z9
CTS7080
CTS7080
R1b-L48 Panel
R1b-L48 Panel
Z343
Z343
S6881
S6881
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies