Top » Catalog » SNPs » Z80

$18.00

Z80
[Z80]

Z80
hg38 Position: ChrY:7487796..7487796
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c2b2b1a3~
Comments: beneath L48. parallel to L47;downstream of Z9. Z10. parallel to Z30
Forward Primer: Z80_F CCAGGAGAGACAACGGTGAG
Reverse Primer: Z80_R TGCATACACATGCACACAAG
Reviews

Customers who bought this product also purchased
Z346
Z346
A11377
A11377
Prepaid Return Envelope
Prepaid Return Envelope
MZ7
MZ7
A11376
A11376
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies