Top » Catalog » SNPs » CTS9882

$18.00

CTS9882
[CTS9882]

CTS9882
hg38 Position: ChrY:17006893..17006893
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1
Comments: Below CTS6507
Forward Primer: CTS9882_F TTCCTCTCCAGCTGTTTTGG
Reverse Primer: CTS9882_R GGCAGAAAAAGAAGGTGCTG
Reviews

Customers who bought this product also purchased
Y21005
Y21005
Y24138
Y24138
Z709
Z709
FGC48929
FGC48929
Y16049
Y16049
L131
L131
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies