Top » Catalog » SNPs » CTS9882

$15.00

CTS9882
[CTS9882]

CTS9882
hg38 Position: ChrY:17006893..17006893
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1
Comments: Below CTS6507
Forward Primer: CTS9882_F TTCCTCTCCAGCTGTTTTGG
Reverse Primer: CTS9882_R GGCAGAAAAAGAAGGTGCTG
Reviews

Customers who bought this product also purchased
CTS11451
CTS11451
CTS6507
CTS6507
FGC30201
FGC30201
M70
M70
T-P77 Panel
T-P77 Panel
CTS6280
CTS6280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies