Top » Catalog » SNPs » CTS9882

$18.00

CTS9882
[CTS9882]

CTS9882
hg38 Position: ChrY:17006893..17006893
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1
Comments: Below CTS6507
Forward Primer: CTS9882_F TTCCTCTCCAGCTGTTTTGG
Reverse Primer: CTS9882_R GGCAGAAAAAGAAGGTGCTG
Reviews

Customers who bought this product also purchased
Y56250
Y56250
M9
M9
L206
L206
Y32894
Y32894
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M74
M74
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies