Top » Catalog » SNPs » CTS9882

$18.00

CTS9882
[CTS9882]

CTS9882
hg38 Position: ChrY:17006893..17006893
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: T1a1a1b2b2b1a1a1
Comments: Below CTS6507
Forward Primer: CTS9882_F TTCCTCTCCAGCTGTTTTGG
Reverse Primer: CTS9882_R GGCAGAAAAAGAAGGTGCTG
Reviews

Customers who bought this product also purchased
P77
P77
BY28589
BY28589
Y21332
Y21332
Y31472
Y31472
HU365
HU365
Y59754
Y59754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies