Top » Catalog » SNPs » M111

$18.00

M111
[M111]

M111
hg38 Position: ChrY:19605419..19605420
Ancestral: ins
Derived: del
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a1a1a
Comments: G3.19
Forward Primer: M111_F AATCTTCTGCAAAGGGTTCC
Reverse Primer: M111_R CAGCTACAAAACAAAATACTGGAC
Reviews

Customers who bought this product also purchased
CTS5854
CTS5854
M1283
M1283
B418
B418
M95
M95
Y26464
Y26464
M1304
M1304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies