Top » Catalog » SNPs » M111

$18.00

M111
[M111]

M111
hg38 Position: ChrY:19605419..19605420
Ancestral: ins
Derived: del
Reference: Underhill et al. 2001
ISOGG Haplogroup: O1b1a1a1a1a
Comments: G3.19
Forward Primer: M111_F AATCTTCTGCAAAGGGTTCC
Reverse Primer: M111_R CAGCTACAAAACAAAATACTGGAC
Reviews

Customers who bought this product also purchased
P331
P331
F145
F145
Z24089
Z24089
PF6107
PF6107
M122
M122
Z24084
Z24084
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies